apteka lubin armii krajowej

Komórki ES poddano elektroporacji za pomocą linearyzowanego wektora, przeszukiwano pod kątem oporności na toksynę błonicy i wstrzykiwano do blastocyst w ośrodku Transgenic Core Facility University of Texas Southwestern. Po ustaleniu transmisji linii płciowej u myszy F1, gen NeoR z intronu natychmiast 3. do egzonu 11 wycięto przez hodowlę ze szczepem eksprymującym rekombinazy Cre. Wszystkie zwierzęta użyte w tym badaniu miały tło 129 / SV. Myszy w wieku 3. 6 miesięcy wykorzystano do badań fizjologicznych. Genotypowanie i ekspresja RNA. Genotypowanie przeprowadzono na DNA z końcówką ogonową, stosując amplifikację PCR z intronowymi starterami flankującymi ekson 11 (do przodu, GACTTAGTGCCTTGGAAAGGTAGGGAGTGTACTGG; reverse, GACAAAAGGAGAAATAAGCATCGAGTGGAGTAAGTGG). Amplimery rozdzielono na 1% żelu agarozowym, w którym wykrywanie zmutowanego allelu wizualizowano jako większe pasmo z zatrzymanego miejsca loxP (580 bp w porównaniu z 500 bp dla WT) lub przez miejsce EcoRV. Całkowity RNA wyizolowano z mięśnia brzuchatego łydki przy użyciu TRI Reagent BD (Sigma-Aldrich). CDNA pierwszej nici syntetyzowano za pomocą systemu SuperScript III (Invitrogen). Amplifikację PCR przez 21 cykli przeprowadzono za pomocą specyficznych względem allelu przednich starterów (R528 naprzód, GGCATCTCTGTGCTCCG, H528 naprzód, GGGATATCTGTGCTCCA) i wspólnego startera wstecznego (AGCAGCAAGAGGGAAGCAAT) rozdzielonego przez około 9 kb sekwencji genomowej. Oczekiwany 128 .l amplimer z matrycy cDNA rozdzielono na 3% żelu agarozowym (NuSieve GTG, Cambrex Bio Science) i potwierdzono sekwencjonowaniem. Względne poziomy ekspresji zostały określone ilościowo za pomocą pomiaru gęstości optycznej i porównane z kontrolą jakości matrycy przy użyciu amplimeru P-aktyny. Badania histologiczne. Myszy znieczulono inhalacją izofluranu i uśmiercono przez przemieszczenie kręgów szyjnych. Segmenty mięśni TA i mięśni brzuchatego łydki / płaszczki uzyskano z myszy WT, R528H + / m i R528Hm / m. W przypadku badań mikroskopowych na światło, segmenty mięśni szybko zamrożono w 2-metylobutanie, ochłodzono w ciekłym azocie i podzielono na 10-.m grubość na obrotowym frymestrze Leitza w ~ 20 ° C. Sekwencyjne skrawki wybarwiono H & E i stosując procedurę NADH-reduktazy tetrazoliowej standardowymi metodami (36). Mięśni używane w badaniach ultrastrukturalnych ustalono izometrycznie w 3% buforowanym fosforanami aldehydem glutarowym. Po utrwaleniu, zorientowane wzdłużnie segmenty mięśnia szkieletowego o średnicy w przybliżeniu mm przemyto buforem fosforanowym, utrwalano przez godzinę w 1% tetratlenku osmu, odwodniono w gradiencie alkoholu etylowego i umieszczono w tlenku propylenu na 10 minut. Segmenty pobrano przez stopniowane inkubacje tlenku propylenu do czystej żywicy i polimeryzowano przez noc w 65 ° C. Po osadzeniu żywicy wycinano segmenty w płaszczyźnie wzdłużnej w odstępach 1,5-.m na ultramikromie Leica Ultracut, barwiono błękitem toluidynowym i oceniano pod mikroskopem optycznym. W celu oceny ultrastrukturalnej bloki żywicy podzielono w płaszczyźnie poprzecznej w odstępach 100 nm, barwiono kolejno octanem uranu i cytrynianem ołowiu i badano za pomocą transmisyjnego mikroskopu elektronowego Hitachi 7500 przy 100 kV. Długoterminowy pomiar CMAP i siły u znieczulonych myszy. Myszy traktowano wstępnie przez 2. 4 dni krówką z dodatkiem sulfonianu sodu polistyrenu (Kayexalate; KVK-TECK Inc.) w celu zmniejszenia wyjściowego pozakomórkowego K +. Poziomy potasu i glukozy mierzono od krwi żylnej pobranej przed i po zakończeniu prowokacji iv insulina plus glukoza, jak opisano wcześniej (22). CMAP i siła w ścięgnie Achillesa u myszy znieczulanych przez inhalację izofluranem monitorowano co 2 minuty w odpowiedzi na elektryczną stymulację nerwu kulszowego, jak opisano wcześniej (22). Pomiar siły tężcowej in vitro Szczytową siłę tężcową zmierzono dla mięśnia EDL stymulowanego bezpośrednio przez równoległe druty ustawione prostopadle do osi włókien, jak opisano wcześniej (22). Pokrótce, EDL szybko rozcięto i zamontowano w łaźni narządowej utrzymywanej w 37 ° C zawierającej (w mM) 118 NaCl, 4,75 KCl, 1,18 MgSO4, 2,5 CaCl2, 1,18 NaH2P04, 24,8 NaHCO3 i 10 glikozy i 0,0220 mU / ml. insulina zawierająca 0,015 mg Zn2 + na 100 jednostek (Humulin R, Eli Lilly and Co.). D-tubokuraryna (0,25 .M, Sigma-Aldrich) została dodana w celu zablokowania aktywacji włókien z zakończeń nerwów ruchowych, a kąpiel była w sposób ciągły barbotowana za pomocą 95% O2 i 5% CO2. Skurcze tężcowe zostały wywołane przez pociąg 30 impulsów o czasie trwania ms, 70 mA przy 250 Hz (A385 Stimulator, WPI Inc.) dostarczanych co 2 minuty. Roztwory testowe zostały wstępnie ogrzane do 37 ° C i
[patrz też: obliteracja, olx bedzin, podział grup społecznych ]