Przewlekła Bartonella quintana Bacteremia u pacjentów bezdomnych ad

Wszyscy pacjenci otrzymali świadomą zgodę. Na wstępnej prezentacji zostały one poddane pełnemu badaniu fizykalnemu, a krew została pobrana do hodowli dla B. quintana i badań serologicznych. Formularz informacyjny z danymi klinicznymi i epidemiologicznymi został wypełniony, a wszy, jeśli są obecne, zostały zebrane. Przeprowadzono rutynowe testy laboratoryjne, w tym testy serologiczne na obecność wirusa HIV. Jeśli ich objawy uzasadniały hospitalizację, można było przyjąć pacjentów. Pacjentów, którzy zostali zwolnieni i którzy powrócili na oddział ratunkowy, byli hospitalizowani, jeśli stwierdzono, że mają bakteriemię lub pozytywne wyniki testów serologicznych na B. quintana. Wszyscy hospitalizowani pacjenci zostali zbadani przez jednego z nas, a dodatkowe próbki zebrano dla hodowli na B. quintana i serologiczne testy serologiczne. Pacjenci hospitalizowani byli następnie leczeni doksycykliną w dawce 200 mg na dzień przez 15 dni, z wyjątkiem przypadku Pacjenta 9, który miał wysokie miana przeciwciał i który był leczony doksycykliną, a także gentamycyną (3 mg na kilogram masy ciała). raz dziennie) przez 4 tygodnie. U pacjentów z mianami przeciwciał większymi niż 1: 400 (pacjenci 7, 9 i 11) wykonano echokardiografię przezprzełykową w celu ustalenia, czy obecne jest zapalenie wsierdzia. Osoby bezdomne, które zgłosiły się do oddziału ratunkowego, zostały użyte jako osoby kontrolne i zostały dopasowane do płci, wieku (w ciągu czterech lat), prezentacji klinicznej i daty prezentacji (w ciągu jednego tygodnia) z pacjentami bezdomnymi. W badaniach serologicznych dodatkowe 250 próbek surowicy uzyskano losowo od zdrowych dawców krwi.
Zbieranie próbek i procedury izolacyjne
Stosowano butelki do hodowli krwi (Bactec Plus, Becton Dickinson Diagnostic Instrument Systems, Sparks, MD). Jeśli po 7 dniach nie wykryto wzrostu bakterii, ml zaszczepionego bulionu do posiewu krwi wysiewano na płytki z agarem z krwią owcy (Columbia, Biomérieux, Marcy l Etoile, Francja) i inkubowano przez 45 dni, zanim hodowla została uznana za negatywną. 9
Identyfikacja izolatów
Reakcja łańcuchowa polimerazy (PCR) została przeprowadzona z wyekstrahowanym DNA z B. quintana hodowanego w agarze (QIAmp Tissue Kit, Qiagen, Hilden, Niemcy) i starterów CS 44310 i CS 979 (TGCATGATTTTTGCACGTGG), które umożliwiają amplifikację syntazy cytrynianowej fragment genu (gltA) (dane niepublikowane). Sekwencjonowanie produktu PCR przeprowadzono za pomocą zestawu do sekwencjonowania AmpliCycle (Perkin Elmer, Foster City, CA) i postaci wyżej wymienionych starterów znakowanych fluoresceiną. Wykryto molekularne wykrywanie B. quintana z wszy, jak podano w innym miejscu.8
Testy serologiczne
Próbki surowicy badano na IgM i IgG za pomocą testu pośredniej immunofluorescencji. B. quintana Oklahoma, szczep referencyjny (dostarczony przez DF Welch, University of Oklahoma, Oklahoma City), B. henselae Houston (American Type Culture Collection 49882) i B. henselae serotyp Marseilles 11 zostały użyte jak opisano wcześniej.12 Serokonwersja została uznana do wystąpienia, jeśli wysokie miano (większe niż 1: 100) zaobserwowano u wcześniej seronegatywnego pacjenta.
Wyniki
Kultury krwi
Tabela 1. Tabela 1. Ludzie bezdomni, którzy przedstawili się w wydziałach ratunkowych w Marsylii w 1997 roku i wyniki badań krwi i testów serologicznych
[podobne: dekstrometorfan, cefepim, dekstran ]
[hasła pokrewne: obliteracja, oct oka, odleżyny leczenie ]